circad | circRNAs associated with diseases

circ0817/CUL5
Gene	CUL5	Organism	Human
Genome Locus	chr11:107916996-107925682:n/a	Build	hg19
Disease	Colorectal Cancer	ICD-10	Malignant neoplasm of rectosigmoid junction (C19)
DBLink	Link to database	PMID	25624062
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	Tumour tissues and matched normal colon mucosa from 31 CRC patients and CRC cell lines (Caco-2, COLO 205, COLO 320HSR, DLD-1, HCT-15, HCT-8, HT-29, LS 174T, SW1116, SW480, SW620)
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ACGTTATTTAGAAACAAGACGAGAATGT Reverse TCATCCCAAAGACAGACTGCAT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Bachmayr-Heyda, A, Reiner, AT, Auer, K, Sukhbaatar, N, Aust, S, Bachleitner-Hofmann, T, Mesteri, I, Grunt, TW, Zeillinger, R, Pils, D (2015). Correlation of circular RNA abundance with proliferation--exemplified with colorectal and ovarian cancer, idiopathic lung fibrosis, and normal human tissues. Sci Rep, 5:8057.